Мутантный штамм гепатита в

Мутантный штамм гепатита в

Hepatitis B genotypes and surface antigen mutants present in Pakistani blood donors
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5459465/

Конкурирующие интересы: BJH, VH и CAB — все сотрудники или пенсионеры Abbott Laboratories. Пакистанский медицинский исследовательский совет, Институт переливания вооруженных сил и Банк крови Хусаини получили финансирование от Abbott Laboratories для этого исследования, а коммерческий анализ, используемый для тестирования HBsAg в Пакистане, является продуктом Abbott Laboratories. Это не меняет нашу приверженность политике PLOS ONE по обмену данными и материалами.

Концептуализация: HQ MAK SAK SJ CAB.

Формальный анализ: BJH VH CAB.

Исследование: BJH VH.

Методология: BJH VH CAB.

Администрирование проекта: HQ CAB.

Ресурсы: HQ MAK SAK NS SJ.

Надзор: CAB.

Визуализация: BJH CAB.

Письмо — оригинальная черновик: BJH CAB.

Написание — обзор и редактирование: HQ MAK SAK SJ NS CAB BJH VH.

Распространенность хронической инфекции вируса гепатита B (HBV) составляет 2-4% в пакистанском населении, определяя Пакистан как промежуточную страну с распространенностью. В этом исследовании было проведено скрининг реактивных пожертвований крови поверхностного антигена гепатита В (HBsAg) с использованием комбинации серологических и молекулярных методов для идентификации мутантных штаммов иммунных побегов HBV и определения генотипов HBV и подтипов, присутствующих в Пакистане.

Пожертвования крови были собраны в Институте переливания вооруженных сил (AFIT), расположенном в северной части Пакистана, и Банке крови Хусейни (HBB), расположенном на юге. С 2009 по 2013 год в общей сложности 706 575 пожертвований были проверены с 2.04% (14 409) HBsAg реактивными. В общей сложности 2055 HBsAg реактивных образцов собирали и скринировали с использованием исследования на основе моноклональных антител для идентификации иммунных белковых мутантов с последующей амплификацией ПЦР и секвенированием ДНК для идентификации присутствующей мутации. Последовательности ДНК, полученные из 192 образцов, включая мутантные кандидаты и штаммы дикого типа, были проанализированы для мутаций-побегов, генотипа и подтипа HBsAg.

Мутации были идентифицированы примерно в 14% реактивных пожертвований HBsAg. Мутации в положениях аминокислот HBsAg 143-145 являются наиболее распространенными (46%), а серотип 143 — лейцином наиболее часто встречающимся изменением (28%). В то время как региональные различия наблюдались, наиболее распространенными штаммами HBV являются субгенотипы D с субгенотипом D1 / подтип ayw2, учитывающие большинство инфекций; 90,2% при AFIT и 52,5% при HBB.

Высокая частота иммунных белков HBV-мутантов у инфицированных HBV пакистанских доноров крови подчеркивает необходимость дополнительных исследований распространенности белковых мутантов. Различия между вакцинированными и невакцинированными популяциями, соотношение частоты побега мутантов с генотипом и влияние побеговых мутаций в разных генотипических фонах на эффективность коммерчески доступных анализов HBsAg представляют собой возможности для дальнейшего исследования.

Данные о нуклеотидной последовательности были внесены в базу данных GenBank под номерами доступа KT201157 — KT201346, KY779733, KY779734.

Вирус гепатита B (HBV) является глобальной проблемой общественного здравоохранения с 15-25% хронически инфицированных лиц, которые развивают тяжелое заболевание и умирают преждевременно из-за цирроза, гепатоцеллюлярной карциномы или гепатита. Всемирная организация здравоохранения (ВОЗ) оценивает примерно 780 000 смертей в год среди 240 миллионов человек с хронической инфекцией HBV [1]. Пакистан классифицируется как страна с промежуточной распространенностью с преобладанием хронической инфекции HBV на 2-4%, а еще 32% населения подвергается воздействию HBV [2]. Распространенность хронической инфекции HBV варьирует между провинциями и внутри них, в сельских и городских населенных пунктах, а также по социально-экономическому статусу. В национальном обследовании, проведенном с 2007 по 2008 год, общая распространенность HBV-поверхностного антигена (HBsAg) составляла 2,5%, а провинциальные показатели варьировались от 4,3% в провинции Белуджистан до 1,3% в северной провинции Хайбер-Пахтунхва с южной провинцией Синд и Пенджаб в 2,5% и 2,4% соответственно [3]. Ali et al. [4] распространенность заболевания составляет от 4 до 11% в регионах провинции Белуджистан по сравнению с 1,5-7% в провинции Пенджаб. Сравнение сельского и городского населения показало, что распространенность HBV в сельской местности в 3,8 раза выше [5], а низкий социально-экономический статус был связан с 2,2-кратной распространенностью [5-7]. Основными факторами риска для заражения вирусом гепатита В в Пакистане являются небезопасные методы, используемые для терапевтических инъекций и инфузий и для барботирования [2, 3, 7, 8]; у мужчин преобладание инфекции HBV в 2,2 раза выше, чем у женщин, что, вероятно, связано с более высокими показателями инъекций и использованием парикмахеров [9].

Передаваемый трансфузией гепатит также является значительным риском в Пакистане; примерно 1,5 миллиона продуктов крови, переливаемых ежегодно, в основном заменяют и направляют пожертвования примерно на 10-15%, полученные от платных доноров [4, 10, 11]. Кроме того, процедуры скрининга крови не регулируются и не стандартизируются [4, 11]. Однако, примечательно, что было отмечено снижение реактивных пожертвований HBsAg [12, 13]. В Институте переливания вооруженных сил (AFIT) 5,2% пожертвований были реактивными HBsAg в 1996 году, снизившись до 1,27% в 2013 году [12, 13]. Тенденция к снижению может быть объяснена повышением осведомленности, что приводит к более безопасной практике инъекций и использованию одноразовых шприцев, а также к скринингу военных новобранцев.

HBV представляет собой окутанный вирус с частично двунитевым кольцевым геномом ДНК. HBV быстро мутирует из-за репликации через подверженную ошибкам обратную транскриптазу, что приводит к высокой скорости мутации (приблизительно 1 точечная мутация за раунд репликации); эта частота ошибок, связанная с высокой частотой репликации у хронически инфицированных людей (> 1011 вирион в день), приводит к эволюции мутантных штаммов HBV [14]. Особую озабоченность вызывают мутации иммунного белка, которые приводят к хронической инфекции HBV; мутанты-побеги возникают в ответ на вакцинацию, лечение иммуноглобулином гепатита и природные нейтрализующие антитела.

HBsAg образует оболочку вириона, а антитела против HBsAg обеспечивают иммунную защиту либо после вакцинации, либо после острой инфекции и естественного удаления вируса. Основной мишенью для нейтрализации антител является «а» детерминант, содержащий аминокислоты 99-160 HBsAg [15]. Внутри «а» детерминанта две петли формируются цистеинами 107 и 138 (петля 1) и 139 и 147 (петля 2), а петля 2 является основной мишенью для вакцин-индуцированных антител [15]. Мутации, связанные с выделением вакцины, были идентифицированы из аминокислот с 116 по 145 [16]. Данные ограничены по частоте естественных мутаций иммунного побега.

HBsAg является основным серологическим маркером для диагностики острой и хронической инфекции HBV. Мутации в HBsAg могут влиять на эффективность коммерчески доступных анализов, используемых для обнаружения HBsAg; указанные мутации в основном расположены в положениях 120-124, 130-133, 142 и 144-145 [15, 17]. В то время как в текущих тестах HBsAg улучшено обнаружение «а» детерминантных мутантов, по-прежнему необходимо контролировать чувствительность к анализу для мутантов HBsAg, циркулирующих в разных популяциях, и влияние основной цепи генотипа на обнаружение мутантов.

Прогнозируемая ошибка репликации HBV также привела к эволюции 9 генотипов HBV. В настоящее время HBV классифицируется на генотипы A-H и предложенный генотип I с субгенотипами для A-D и F [18]. Генотипы отличаются друг от друга на уровне нуклеотидов более чем на 7,5% по всему геному, тогда как под генотипы отличаются в пределах генотипа более чем на 4%. Генотипы развивались в разных географических регионах, но со временем распространение диверсифицировалось [18]. Генотипы A-D являются наиболее распространенными штаммами и могут быть найдены во всем мире. Тем не менее, распространенность генотипа А самая высокая в Южной и Восточной Африке, генотип В является самым высоким в Юго-Восточной и Восточной Азии, генотип С является самым высоким в Восточной Азии и на островах Тихого океана, а генотип D является самым высоким в Северной Африке и на западе, в Центральной и Южной Азии. Генотипы E-H менее распространены с генотипом E, обнаруженным главным образом в Центральной и Западной Африке, генотипом F в Центральной и Южной Америке и генотипами G и H в Центральной Америке.

Отчеты о генотипах HBV, циркулирующих в Пакистане, показывают противоречивые результаты. Резюме 10 исследований показало, что общий генотип D (63,7%) преобладает в Пакистане, но распространенность варьировала от 8% в одном исследовании до 100% в другой [19]. Разница в распространенности генотипов между этими отчетами может быть связана с различиями в популяции или с методологией, используемой для определения генотипа. В двух исследованиях, в которых использовалась ПЦР, специфичная для генотипа HBV, были получены разные результаты. В одном исследовании молекулярной эпидемиологии пациентов из больниц в 4 провинциях сообщалось преимущественно генотип D (65,3%), за которым следуют генотип B (26,7%) и генотип A (4,9%) [9]. Напротив, в другом исследовании сообщалось преимущественно генотип С (28%), за которым следуют генотип В (18%), генотип А (14%), генотип D (13%), генотип Е (0,6%) и генотип F (1,3%), [20]. Для этого последнего исследования штаммы HBV были получены главным образом в провинции Пенджаб, где основным типом был генотип С; генотип С также был наиболее распространен в Хайбер-Пактуонхва, а генотип В преобладал в Белуджистане, а генотип А был наиболее распространен в Синд [20]. Третье исследование, в котором скрининг пациентов по всей стране, используя коммерческий анализ генотипирования на основе зонда, выявил распространенность генотипа D 96% [21].

В этом исследовании реактивные пожертвования крови HBsAg использовались для характеристики штаммов HBV, циркулирующих в Пакистане. Пожертвования были собраны в двух банках крови, один из которых находился в Равалпинди, Пенджабе (Север) и один в Карачи, Синд (Юг). Мы провели серологический анализ для идентификации мутантов HBsAg и амплификации ПЦР HBV с последующим секвенированием для характеристики штаммов HBV, обнаруженных у инфицированных доноров крови. Последовательности HBsAg оценивали для идентификации мутаций-побегов и определения генотипа и подтипа.

Для этого исследования реактивные образцы HBsAg, идентифицированные обычным анализом крови, были собраны в Институте переливания (AFIT) Вооруженных сил и банке крови Хусейни (HBB) с 2009 по 2013 год. AFIT, региональный центр крови, расположенный в северном Пакистане в провинции Пенджаб, обслуживает больницы вооруженных сил в Равалпинди и Исламабаде и гражданские больницы в регионе [13]. В ходе исследования было отобрано 267 918 доноров крови, в ходе которых 1,45% были реактивными для HBsAg. Население популяции AFIT составляло 99% мужчин со средним возрастом 28 лет (18-18 лет). HBB базируется в Карачи в южном регионе провинции Синд с местами в городах Карачи, Бадин и Якобабад и обслуживает больницы по всей стране. В ходе исследования было проведено скрининг в общей сложности 438 657 доноров крови, в отношении которых 2,4% были реактивными для HBsAg. Население HBB-доноров составляло 96% мужчин со средним возрастом 27 лет (18-18 лет). Для этого исследования было собрано 2055 случайно выбранных реактивных образцов с доступным объемом; 957 от AFIT и 1098 от HBB.

Для идентификации штаммов HBV, несущих мутации в белке поверхностного антигена, образцы-доноры, реактивные для HBsAg, подвергали скринингу с использованием исследовательского анализа, предназначенного для идентификации диагностических и вакцинных мутаций-побегов на основе дифференциального связывания с 3 мышиными моноклональными антителами (MAbs). MAb H166 связывает эпитоп (E1), определенный как аминокислоты (aa) 121-124 в пределах «a» детерминантной петли 1 (aa 107-138) HBsAg [22]. MAb H57 связывает эпитоп (E2) внутри цикла 2 (aa 139-147). MAb H53 связывает конформационный эпитоп, который отображает на разрывные сегменты HBsAg, aa 112-117 в детерминанте «a» и aa 182-207 вне «a» детерминанта [22]. Как показано на фиг.1, образцы, которые являются нереактивными или имеют низкую реакционную способность к H166, но являются реакционноспособными для H53 и H57, указывают на мутацию в E1. И наоборот, образцы, которые являются нереактивными или имеют низкую реакционную способность к H57, но реакционноспособны для H53 и H166, указывают на мутацию в E2. Образцы, нереактивные для всех 3 MAbs, могут указывать на наличие мутаций, которые вызывают основные конформационные изменения HBsAg, или могут быть связаны с тем, что уровень HBsAg ниже чувствительности анализа. Образцы, которые реагируют на все 3 MAb, классифицируются как дикие. На рис. 1 образцы дикого типа образуют тренд, где значения сигнала к шуму (S / N) для каждого MAb относительно других образуют линейную корреляцию. Образцы с величинами H166 S / N, которые падают ниже линии тренда дикого типа, близкой к оси x, классифицируются как мутанты E1; то есть H166 имеет очень низкое или нереактивное значение относительно значений H53 и H57 S / N. Возможные мутанты E1 лежат между осью х и линией тренда; то есть значение H166 S / N является низким относительно H53 и H57, но не является реактивным. Образцы, классифицированные как мутанты E2, падают над линией тренда, близкой к оси y; то есть S / N для H57 является очень низким или нереактивным, тогда как значения S / N для H53 и H166 являются относительно высокими. Возможные мутанты E2 лежат между осью Y и линией тренда.

Значения S / N для каждого образца нанесены с использованием значений MAb H53 и H166 по значениям оси y и MAb H57 по оси x. Значения MAb H53 показаны заполненными кружками, а MAb H166 — заполненными треугольниками; красным цветом обозначены точки с данными о выбросах, идентифицирующие образцы-кандидаты-мутанты, а серые и черные обозначают точки данных дикого типа.

Мутантный анализ HBsAg использовали для скрининга всего 2055 образцов-доноров с 60 (2,9%), классифицированных как мутанты и возможные мутанты (таблица 1). Семьдесят три (3,6%) образца были нереактивными в мутантном анализе, а 1922 (93,5%) были классифицированы как дикие. Чтобы подтвердить наличие мутаций HBsAg и идентифицировать аминокислотные изменения, ПЦР-амплификацию с последующим секвенированием ДНК проводили на 60 образцах, классифицированных как мутанты / возможные мутанты. Последовательность для «a» определителя HBsAg была получена из 55 из 60 (92%) кандидатов-мутантов (таблица 1). Мутации HBsAg с иммунным побегом были идентифицированы с использованием критериев программного обеспечения Geno2pheno (hbv) v2.0 [23]. Мутации в положении аминокислоты 123 не были классифицированы как мутации-побеги Geno2pheno, но были включены в наш анализ, поскольку они попадают в E1. Некоторые мутации, которые Geno2pheno классифицирует как escape-мутации, на самом деле являются общими для конкретного генотипа HBV и были исключены из числа мутаций. Те, которые были опущены, включали R122K, который является определяющим фактором для подтипирования HBsAg как ad против ay, T126I для генотипа C, A128V для генотипа D2 и T131N для генотипа A1.

** A & D двойная инфекционная последовательность не анализировалась

* включает P120X и T123S, которые не являются мутантами-побегами, но находятся в эпитопе E1

^ опустить T126I для генотипа C, A128V для генотипа D2 и T131N для генотипа A1

Для кандидатов мутанта E1 57% (4 из 7) подтвердили наличие мутаций в эпитопе E1, причем один из них также имеет мутацию в эпитопе E2. Одним из кандидатов была двойная гетерогенная инфекция генотипов А и D; смешанная последовательность предотвращала анализ мутаций. Мутации E2 присутствовали в 66,7% (14 из 21) кандидатов E2, у которых также была мутация в E1, а одна имела 2 мутации вне E1 и E2. Образец, классифицированный как мутант E1 и E2, имел одну мутацию-побег в E1. В целом, для тех ПЦР-положительных моноинфицированных образцов мутант HBsAg, классифицированный как мутанты, 65,5% (19 из 29) были подтверждены секвенированием ДНК.

Было 8 образцов, классифицированных как возможные мутанты E1, и только 2 имели мутации с исчезновением, расположенные вне E1 и E2. Из 20 возможных мутантов E2 1 была двойной гетерогенной генотипической А и D-инфекцией и не анализировалась, 3 были отрицательными по ПЦР, и только у 5 из оставшихся 16 были белки-мутаций в E2, причем один из них имел 2 дополнительных мутации вне E1 и E2 , Из 24 возможных мутантов секвенирование подтвердило только 29,2% (7 из 24) как имеющих мутантные белки HBsAg.

Для образцов, которые были нереактивными в мутантном анализе, только 38 из 62 (61%, 11 из 73 имели недостаточный объем для ПЦР) были ПЦР-положительными и у этих 21% (8 из 38) были белки-мутации; 1 имел 2 мутации внутри E1, 2 имел мутации внутри E2, 1 имел 2 мутаций-побегов внутри E2 плюс 1 вне E1 и E2, а 4 имел мутации вне E1 и E2 (таблица 1). Более низкая ПЦР-положительность для нереактивных образцов, по-видимому, частично отражает отражение чувствительности к HBsAg. Например, многие из этих образцов имели низкий уровень антигена и вируса и, таким образом, были нереактивны в мутантном анализе, но реакционноспособны для HBsAg в более чувствительном аналитическом анализе крови ARCHITECT HBsAg, используемом банками крови для скрининга крови.

Для оценки мутаций HBV у пакистанских доноров крови беспристрастно, 108 образцов, классифицированных как дикий тип с помощью анализа HBsAg и распределенных примерно равномерно между двумя сайтами, были случайно выбраны для амплификации и секвенирования ПЦР; 99 из 108 (92%) были ПЦР-положительными (таблица 1). Удивительно, что у 13,1% (14 из 99) образцов были обнаружены мутации HBsAg с 9 из 14 (64%), имеющих мутации вне E1 и E2, 4, имеющие мутации внутри E2 и 1, имеющие мутацию внутри E1.

Чтобы оценить общую распространенность мутантов-побегов HBV в популяциях-донорах Пакистана в этом исследовании, необходимо учитывать смещение отбора, введенное нашим мутантным скрининговым анализом. Поэтому общая распространенность экстраполируется на основе процента мутантов, подтвержденных последовательностью ДНК, в каждой классификации мутантного анализа (то есть мутант, возможный мутантный, нереактивный и дикий тип), взвешенный по проценту от общей численности населения, представленного каждой классификацией. Из этого расчета мы оцениваем, что 14% реактивных пожертвований HBsAg содержат упущенные мутации в исследуемой популяции.

Основываясь на последовательностях ДНК HBV у 192 особей, в общей сложности 48 перенесенных штаммов HBV, содержащих мутации-побег. Эти 48 последовательностей содержали в общей сложности 61 мутации-побега. Частота эвакуационных мутаций в положениях 28 аминокислот в определителе HBsAg «a», который Geno2pheno классифицирует как escape-мутации, показана на фиг. 2; мутации были расположены в 14 положениях аминокислот в «а» детерминанте HBsAg. Мутации наиболее часто встречались в E2 с 28 (46%) в положениях 143-145, а наиболее часто мутированным было серин 143 (n = 17; 28%). Всего в E1 присутствовало 9 мутаций, тогда как за пределами E1 и E2 произошло 24 мутации (рис. 2).

Показана частота мутаций в каждой аминокислотной позиции в определителе HBsAg «a», определяемом как сайты escape-мутаций Geno2pheno v2.

Номенклатура для обозначения используемых здесь мутантов представляет собой один буквенный код для аминокислоты дикого типа, положение аминокислоты в HBsAg и однобуквенный код для мутантной аминокислоты; например, P120S обозначает пролин в положении 120, измененном на серин. Когда последовательность ДНК указывала более одного базового вызова в положении, были перечислены все возможные аминокислоты, такие как P120PS для смеси пролина и серина в положении 120. Шесть штаммов имели мутации исключительно в E1, включая изменения на P120, которые были включены с мутациями E1, поскольку 3 мутанта P120S были классифицированы как мутанты E1 в мутантном анализе HBsAg. Мутанты E1 включали P120S (n = 3), P120PS (n = 1), P120PT плюс T123TI (n = 1) и T123S (n = 1). Было 2 штамма, которые имели мутации как в E1, так и в E2; T123TS плюс S143L и T123TI плюс S143SL. В общей сложности 22 штамма имели мутации только внутри E2; S143L (n = 11), S143SL (n = 3), D144A (n = 1), D144E (n = 2), D144DG (n = 1), G145A (n = 2) и G145GR (n = 2). Три штамма имели мутации внутри E2 плюс дополнительные мутации вне E1 и E2; S143SL, T131TN и M133MT (n = 1), D144A, G145A и M133I (n = 1) и G145R, T126TI и Y134YN (n = 1). Наконец, 15 штаммов имели мутации вне E1 и E2; Y100C плюс Q129R (n = 1), L109LR (n = 1), T126S (n = 1), T126TS (n = 1), A128V (n = 1), Q129H (n = 1), Q129QH (n = 1) (N = 1), T131TN (n = 1), T131I (n = 1), T133TLMS (n = 1), Y134S (n = 1) и Y134YN (n = 1). Краткое изложение изменений аминокислот показано в таблице 2.

Для 37 из 61 (60,7%) мутаций было полное изменение мутантной аминокислоты, тогда как остальные 24 (39,3%) имели смесь дикого типа и мутантных аминокислот. Следует отметить, что для подтвержденных мутантов, классифицированных как мутант или возможный мутант методом мутанта HBsAg, 77% (20 из 26) мутаций в E1 и E2 не были смесями дикого типа и мутантных аминокислот. Напротив, только 5 из 14 (35,7%) белковых мутантов, классифицированных как дикий тип с помощью мутантного анализа, имели мутации в эпитопах E1 или E2, а 3 из 5 имели смеси дикого типа и мутантных аминокислот. Кроме того, 64% (9 из 14) белковых мутантов с классификацией дикого типа с помощью мутантного анализа HBsAg имели мутации вне эпитопов E1 и E2, причем 4 имели смеси дикого типа и мутантных аминокислот.

Последовательности ДНК HBV, полученные из 192 образцов доноров, использовались для определения генотипов и подтипов HBsAg, циркулирующих в популяции исследования (номера доступа Genbank KT201157-KT201346, KY779733, KY779734). Представленные генотипы включают A1, C, D1, D2, D3 и D5, а подтипы включают adw, adr и ayw. В целом, генотип D1 / подтип ayw2 составлял 74,5% инфекций HBV, D2 / ayw3 для 8,9%, A1 / adw2 для 5,7% и 11 других комбинаций генотипа / подтипа присутствовали на низких уровнях (рис. 3A). В то время как эти три категории занимали большинство штаммов на обоих участках, различие между штаммами было совершенно иным, чем между двумя банками крови. В AFIT подавляющее большинство инфекций было вызвано D1 / ayw2, на долю которых приходилось 90,2% (101 из 112) штаммов, присутствующих в популяции доноров; D2 / ayw3 и A1 / adw2 составляли только 2,7% (n = 3) и 1,8% (n = 2) инфекций соответственно (рис. 3B). Напротив, в HBB присутствовало большее разнообразие штаммов; 52,5% (42 из 80) были D1 / ayw2, 17,5% (14 из 80) были D2 / Ayw3, а 11,3% (9 из 80) были A1 / adw2 (фиг.3C). Генотипы C (n = 3), D3 (n = 2) и D5 (n = 1) были обнаружены на низких частотах и ​​только на сайте HBB. Филогенетическое дерево, показанное на фиг. 4, было построено из репрезентативного подмножества последовательностей генотипов, имеющихся у пакистанских доноров, для иллюстрации масштабов генетического разнообразия HBV, циркулирующего среди населения. Следует отметить, что для генотипов, присутствующих в популяциях доноров AFIT и HBB, дерево не обнаруживает значительного филогенетического разделения географически различных последовательностей.

(A) показывает процент каждого генотипа / подтипа, полученного из 192 последовательностей ДНК HBV; 74,5% (143 из 192) были генотипом D1 / подтипом ayw2. (B) показывает количество каждого генотипа / подтипа, идентифицированного в популяции доноров AFIT; 101 из 112 (90,2%) были генотипом D1 / подтип ayw2, а 7 других штаммов генотипа / подтипа присутствовали на низких уровнях. (C) показывает количество каждого генотипа / подтипа, идентифицированного в популяции доноров HBB; 42 из 80 (52,5%) были генотипом D1 / подтипом ayw2, 14 (17,5%) были D2 / ayw3, 9 (11,3%) были A1 / adw2, а 10 других штаммов генотипа / подтипа присутствовали на низких уровнях. Во всех диаграммах порядок меток данных в легенде соответствует по часовой стрелке порциям пирога, начиная сверху.

Филогенетическое дерево было получено из выравнивания подмножества последовательностей ДНК HBV (n = 55), выбранных для представления всех мест отбора проб, лет сбора и генотипов, идентифицированных в популяции доноров, выровненных по сравнению с эталонными последовательностями HBV, как описано в Материалах и методах. Значения Bootstrap показаны для основных ветвей. Синие квадраты указывают последовательности доноров AFIT, а красные круги указывают последовательности от доноров HBB. Для улучшения визуализации количество последовательностей ограничивалось подмножеством общего числа.

Скрининг здоровых доноров крови на банках крови AFIT и HBB в Пакистане показал распространенность хронической инфекции HBV на 2,0%; распространенность составила 1,4% при AFIT и 2,4% при HBB. Поскольку дизайн исследования был сосредоточен на хронических инфекциях от реактивных доноров HBsAg и пропустил оккультные инфекции HBV, истинная распространенность инфекции HBV в Пакистане может быть выше, чем наблюдалось в этом исследовании. Хотя популяции доноров обычно считаются представителями общего взрослого населения, это не относится к нашему исследованию, так как самцы составляют 97% доноров (99% при AFIT и 96% при HBB). Молекулярная характеристика подмножества образцов реактивного донора HBsAg показала, что приблизительно 14% штаммов HBV содержали мутации иммунного побега. Эта распространенность среди реактивных доноров HBsAg также может быть недостаточным представлением истинной распространенности, поскольку оккультные инфекции могут возникать в результате мутаций в HBsAg «a» детерминанте. Филогенетический анализ последовательностей ДНК показал, что генотип D преобладает с субгенотипом D1 / подтипом ayw2 в качестве наиболее распространенного штамма, циркулирующего в исследуемой популяции.

Мы использовали мутантный анализ HBsAg в попытке идентифицировать белки-мутанты. Анализ классифицировал 1,6% образцов в качестве мутантов и еще 1,4% в качестве возможных мутантов, из которых 65,5% и 29,2% были подтверждены секвенированием ДНК соответственно. Однако распространенность белковых мутантов была недооценена анализом, поскольку она не была предназначена для идентификации мутаций-побегов вне E1 (aa 120-124) и E2 (aa 139-147). Секвенирование ДНК образцов, классифицированных как дикий тип с помощью мутантного анализа, выявило 13% скрытых мутаций-побегов, из которых 64% выпадали за пределы E1 и E2. Кроме того, многие инфекции, которые были смесью мутантного и дикого типа, имели фенотип дикого типа в мутантном анализе. Хотя анализ мутантов, использованный в этом исследовании, усиливал идентификацию мутантов эпитопа 1 и 2, эффективное серологическое обнаружение мутантов HBsAg было бы улучшено за счет использования более широкого диапазона MAbs с четко определенными эпитопами. Альтернатива использования секвенирования ДНК HBV для идентификации мутантов также имеет свои ограничения. Когда последовательность ДНК указывает на смесь вирусов дикого типа и мутантного вируса, нет способа узнать относительный уровень экспрессии HBsAg от каждого вируса. В этом исследовании 39% мутаций были смесями дикого типа и мутантными аминокислотами и попадали в эту категорию. Кроме того, антигенность HBsAg не всегда может быть выведена из последовательности ДНК, поскольку генетический фон в отдаленных положениях аминокислот может играть роль в «а» детерминантной структуре и распознавании эпитопа [24]. Мы наблюдали, что профили эпитопов HBsAg не всегда коррелировали с аминокислотной последовательностью, полученной ДНК, как отмечалось ранее ранее [24]. Несмотря на эти ограничения, комбинированное использование серологических и молекулярных методов позволило идентифицировать иммунных белковых мутантов у пакистанских доноров крови. Наиболее распространенные мутации были обнаружены в E2 в положениях аминокислот 143, 144 и 145, которые, как было показано, влияют на чувствительность диагностического анализа, так как P120S является наиболее распространенным мутатором E1, наблюдаемым в этом исследовании [15, 25]. В то время как более новые версии анализа показывают улучшенное обнаружение мутантов, продолжающаяся оценка влияния мутантов на чувствительность должна продолжаться [25, 26]. Примечательно, что все образцы с мутациями иммунного бегства были обнаружены качественным диагностическим тестом ARCHITECT HBsAg.

В 2002 году Пакистан инициировал программу вакцинации детей HBV в детском возрасте и обеспечил охват детей от 72 до 87% [7, 8, 27]. Показатель вакцинации для общего взрослого населения низкий (1,2%) по сравнению с работниками здравоохранения (73%) [5, 28]. Поскольку донорство крови в нашем исследовании было собрано с 2009 по 2013 год у доноров в возрасте 18 лет и старше, большинство нашего населения родилось бы, по крайней мере, за 7 лет до того, как была проведена вакцинация против гепатита В, и вряд ли она будет вакцинирована. Поэтому мы заключаем, что белки-спутники, присутствующие в популяции доноров, обусловлены естественным иммунологическим ответом, а не побегом вакцины. 14% распространенности белковых мутантов аналогичны сообщениям из других стран. Исследование, проведенное в четырех африканских странах, в основном невакцинированных популяциях, показало, что у взрослых мутантов у взрослых 7,7% [29]. В исследовании хронических инфекций HBV в Испании 12,5% пациентов страдали штаммами с одной или несколькими мутациями, связанными с побегом, а еще 26% имели другие аминокислотные замены в «а» -референтанте [30].

Как упоминалось ранее, сообщения о генотипах HBV, присутствующих в Пакистане, широко варьируются [19]. Наши данные указывают на региональные различия, но согласны с общим консенсусом в отношении того, что преобладают штаммы генотипа D. В совокупности все субгенотипы D составляли 91% штаммов HBV с 97,3% в AFIT (северная провинция Пенджаб) и 82,5% в HBB (южная провинция Синд). Субгенотипы A составили 6,3% в целом с 1,8% и 12,5% в AFIT и HBB, соответственно. Ранее генотип C был зарегистрирован как наиболее распространенный генотип в провинции Пенджаб [20], но мы нашли его всего в 1,5% всех последовательностей и только на сайте HBB. Отсутствие генотипа B в нашем населении может указывать на то, что B в основном встречается в провинции Белуджистан [20]. Из-за преобладания генотипа D1 в этой популяции не было выявлено четких закономерностей в отношении между генотипом и наблюдаемыми частотами мутаций.

Частота иммунных белков HBV-мутантов, по нашему мнению, является в значительной степени невакцинированной популяцией, подчеркивает необходимость в дополнительных исследованиях распространенности мутантов-побегов. Разнообразие и влияние мутаций HBsAg следует учитывать при выборе анализа, используемого для скрининга. В то время как коммерческие анализы рассматривали ранее выявленные проблемы обнаружения мутантов, необходимо сохранить бдительность их чувствительности. Различия между вакцинированными и невакцинированными популяциями, соотношение частоты побега мутантов с генотипом и влияние мутаций-побегов в разных генотипических фонах на эффективность коммерчески доступных анализов HBsAg будут важными областями для будущих исследований.

Сбор образцов реактивной крови HBsAg для использования в исследованиях HBV был одобрен Комитетом по этике исследований в Пакистанском медицинском исследовательском совете (F4-87 / NBC / EC-Project-13/852). Образцы были собраны в банке крови Института переливания крови (AFIT) в Равалпинди и банке крови Хусейни (HBB) в Карачи с 2009 по 2013 год. Банки крови использовали анализ ARCHITECT® HBsAg Qualitative (Abbott Diagnostics, Wiesbaden, Germany) для экран 706,575 доноров крови на присутствие HBsAg. Основываясь на доступности объема, образцы 2055 HBsAg были случайно выбраны для исследования.

Образцы скринировали на потенциальных мутантов HBsAg, используя автоматизированный исследовательский анализ, основанный на качественном анализе Abbott ARCHITECT HBsAg. Анализ мутантного экрана использует 3 различных магнитных микрочастицы, каждый из которых покрыт моноклональным антителом против HBsAg (MAb) для захвата антигена, присутствующего в образце донорной плазмы. Захваченный антиген затем детектируют с использованием поликлонального антитела против HBsAg, конъюгированного с хемилюминесцентным соединением акридиний. Использовали MAbs до эпитопа 1 (аминокислоты 121-124), эпитоп 2 (139-145) и третий конформационный эпитоп из двух разных областей HBsAg (112-117 и 187-207). Образцы были классифицированы как мутант, возможный мутант, нереактивный или дикий тип, основанный на относительных соотношениях сигнал-шум для трех MAbs.

Общая нуклеиновая кислота экстрагировалась из 200 мкл плазмы с использованием набора QIAamp® DNA Blood Mini QIAcube Kit и QIAcube (Qiagen Inc., Valencia, CA) и элюировалась в 100 мкл свободной от нуклеазы воды. Первую и вложенную ПЦР-амплификацию проводили с использованием набора GeneRAP PCR с ДНК-полимеразой AmpliTaq (Applied Biosystems, Carlsbad, CA). Первыми круглыми праймерами, нацеленными на геном S, были либо HBV-3194F (ACASTCATCCTCAGGCCATGCAGTGG), либо HBV-13F (CCACCAARCTCTGCWAGATCCCAGAG) с обратным праймером HBV-1161bR (TTGCCGRGCAACGGGGTAAAGG), амплифицирующим фрагмент длиной 1189 или 1149 пар оснований соответственно. Вторые круглые праймеры были либо HBV-13F, либо HBV-56F (CCTGCTGGTGGCTCCAGTTC) с обратным праймером HBV-1003R (GCGGCAAACCCCAAAAGACC), амплифицирующим фрагмент из 1010 или 967 пар оснований соответственно. Первая реакционная смесь (50 мкл) содержала 0,4 мкМ каждого праймера, 0,25 мМ каждого dNTP и 20 мкл нуклеиновых кислот. Первый раунд амплификации состоял из денатурации при 94 ° C в течение 2 минут с последующим 10 циклами 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 90 секунд и 30 циклов 94 ° C в течение 30 секунд , 60 ° C в течение 30 секунд и 72 ° C в течение 90 секунд с окончательным удлинением при 72 ° C в течение 10 минут. Вложенная реакция ПЦР (50 мкл) содержала 0,4 мкМ каждого праймера, 0,25 мМ каждого дНТФ и 2 мкл реакции первого цикла ПЦР. Амплификация состояла из денатурации при 95 ° С в течение 1 минуты, 40 циклов 94 ° C в течение 15 секунд, 55 ° C в течение 30 секунд и 72 ° C в течение 90 секунд, а окончательное удлинение при 72 ° C в течение 10 минут.

ПЦР-продукты очищали с использованием Illustra ExoProStar Purification (GE Healthcare UK Limited, Buckinghamshire, UK) и секвенировали непосредственно с использованием набора реагентов для тестирования последовательности циклов Big Dye Terminator Cycle Sequencing v3.1 и генетического анализатора ABI 3130xl (Applied Biosystems). Данные последовательности анализировали с использованием Sequencher 5.2.3 (Gene Codes Corp., Ann Arbor, MI).

Для определения генотипа последовательности ДНК HBV были выровнены с эталонными последовательностями генотипов с использованием метода CLUSTAL (MegAlign, Lasergene, DNASTAR Inc., Madison, WI) и вручную отредактированы в редакторе выравнивания последовательностей BioEdit (версия 7.2.5) [31]. Филогенетический анализ проводили с использованием PHYLIP (версия 3.5c, J. Felsenstein, University of Washington, Seattle, WA). Эволюционные расстояния оценивались с помощью Днадиста (двухпараметрический метод Кимуры), а филогенетические отношения определялись соседом (метод соседнего соединения). Отражательная воспроизводимость деревьев оценивалась с использованием Seqboot (100 повторов) и Consense. Программы выполнялись с параметрами по умолчанию. Деревья были визуализированы с использованием FigTree (версия 1.4.2, A. Rambaut, Institute of Evolutionary Biology, Эдинбургский университет, Эдинбург) с последовательностью шимпанзе AF242585 в качестве внешней группы. Последовательности, основанные на ветви генотипа, были исследованы на контрольные точки рекомбинации с SimPlot (версия 3.5.1, S. Ray, University of Johns Hopkins, Baltimore, MD) [32].

Эталонные штаммы следующего генотипа (номер доступа в Genbank генотипа-) был использованы в выравниваниях: A1-AF297623, AF418676 А1-А1-EU366129, А1-M57663.2, А1-U87742.3, А2-AF297624, А2-AP007263, А2-V00866, А3-AB194951, А3-GQ161813, А5-FJ692554, А5-FJ692555, А6-GQ331046, А6-GQ331047, А6-GQ331048, В-D00329, D00331 В-B-D50522, В-M54923, С- D23681, С-D23682, С-X04615, С-X75656, D-X59795, Д-Y07587, Е-AB194947, Е-AB194948, Е-AP007262, Е-X75657, Е-X75664, F-AB036910, F-X69798, F-X75658, X75663 F-G-AB056514 G-AB375165 G-AP007264 G-DQ207798, Н-AP007261, Н-AY090454, Н-AY090457, Н-AY090460 I-AB231908 I-FJ023664, A3- AB194952, А5-FJ692556 G-AB064310 G-AF160501, D1-AB104711, D1-AF121239, D1-AF151735, D1-AF280817, D1-AY721611, D1-AY741796, D1-AY945307, D1-X02496, D2-AB078033, D2-AY090453, D2-AY341335, D2-X72702, D3-AJ344117, D3-AY233296, D3-AY373430, D3-DQ111987, D3-X85254, Д4-AB033559, Д4-AB048702, Д5-AB033558, Д5-DQ315780, Пан- CHIMP-2-AF242585.

Подтип HBsAg определяли, как описано в Purdy et al. [33]. Выпущенные мутации HBsAg были идентифицированы с использованием веб-программы Geno2pheno (hbv) v2.0 [23].

Авторы признательны г-ну Сарбиланду, г-ну Сааду Сиддику и г-ну Мухаммаду Акифу Ян, Abbott Laboratories Pakistan Ltd. за необходимую материально-техническую поддержку. Мы благодарим Sheng Lou, Abbott Diagnostics, за техническую поддержку и Мэри Роджерс, Abbott Diagnostics, за критический обзор рукописи.



Источник: rupubmed.com


Добавить комментарий